Archives

  • 2022-09
  • 2022-08
  • 2022-07
  • 2022-06
  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2020-03
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • br Total RNA extraction from plasma br

    2022-09-14


    2.2. Total RNA extraction from plasma
    Whole blood samples were collected from participants after an overnight fasting in EDTA-containing tubes. RNA was extracted from plasma using the miRNeasy Serum/Plasma Kit (Qiagen, Valencia, CA, USA) as per the manufacturer's instructions. RNA spike-in (synthetic Caenorhabditis elegans miRNAss cel-miR-39) was used as an exogenous miRNAs control for normalization of sample-to-sample variation in the RNA isolation procedure.
    2.3. Quantitative RT-PCR of plasma lncRNAs
    First strand cDNA was synthesized from total RNA using cDNA synthesis kit (Takara, Japan). Real-time PCR was performed using SYBR Premix Ex TaqTM II (Takara, Japan) and specific primers (Table 1) for  Gene 687 (2019) 135–142
    Table 1
    Sequences of primers used in this study.
    miR-141-3p GGGGTAACACTGTCTGGTAAAGAT miR-675-5p TGCAGAGAGGGCCCACAG miR-148a-3p GGGTCAGTGCACTACAGAACTTT miR-181a-5p AACATTCAACGCTGTCGGTGA H19 Forward: ATCGGTGCCTCAGCGTTCGG
    Reverse: CTGTCCTCGCCGTCACACCG MEG3 Forward: TGGCATAGAGGAGGTGAT
    Reverse: AGACAAGTAAGACAAGCAAGA GAPDH Forward: ATGGTGAAGGTCGGTGTGA
    Reverse: CCATGTAGTTGAGGTCAATGAG
    H19, MEG3 and GAPDH in triplicate according to the standard program on Rotor-Gene Q instrument (QIAGEN). The relative Gilteritinib of lncRNAs was calculated using the 2− Ct method and normalized using the GAPDH as the internal control.
    2.4. Quantification of plasma miRNAs
    The total RNA was reverse-transcribed using the Mir-X miRNA First-Strand Synthesis Kit (Takara, Japan). For miRNA quantification, real-time PCR was performed with SYBR Premix Ex TaqTM II (Takara, Japan). Two microliter template cDNA mixed with 12.5 μl 2× SYBR Green PCR master mix and 1 μ of each reverse (mRQ 3′ Primer, Takara) and forward primers (Table 1) in a final volume of 25 μl. The PCR was performed in triplicate according to the standard program on Rotor-Gene Q instrument (QIAGEN). The relative expression of miRNAs was determined using the 2− Ct method by subtracting the Ct value of U6 snRNA as a reference gene from the Ct value of each miRNA. U6 primer sets provided by Mir-X miRNA First-Strand Synthesis Kit.
    2.5. In-silico analysis: miRNA target genes enrichment
    A list of experimentally validated target genes of miR-675-5p, miR-148a-3p, miR-181a-5p and miR-141-3p obtained from miRTarBase database (Chou et al., 2017). Subsequently, to explore functional an-notation and pathway enrichment of the extracted target mRNAs, the KEGG pathway enrichment analysis was carried out using the Database for Annotation, Visualization and Integrated Discovery (DAVID) (https://david.ncifcrf.gov/), database (Huang et al., 2008).
    2.6. Statistical analysis
    All statistical analysis was performed by SPSS Statistical Software Package (version 18.0). The assessment of normality was done by the Kolmogorov-Smirnov test. The comparisons of the ncRNAs expression levels between the GC patients and controls were evaluated using stu-dent's t-test for the normally distributed data or Mann-Whitney U test for the nonparametric data. ANOVA and Kruskal-wallis tests were used for the comparisons of ncRNAs expression levels between three or more groups for the normally distributed and for the nonparametric data, respectively. The relationship between ncRNAS level and clin-icopathological features was evaluated by a chi-square test. The median expression value of each ncRNAs was used to classify high and low RNA expression groups. P values < 0.05 were considered to be statistically significant.
    A receiver operating characteristic (ROC) curve provided by MedCalc software was used to assess the feasibility of using ncRNAs as a diagnostic marker for the GC. The best sensitivity/specificity pair was selected based on the maximum Youden Index. Moreover, logistic re-gression analysis in ROC curve was used to identify the best combina-tion of ncRNA to for diagnosis.